how to know what bacteria a pcr product is for an unknown organism

Abstract

Declining in bacteria isolation in a significant number of infections might be due to the involvement of microorganisms nonrecoverable in culture media. The presence cannot be ruled out of nondividing cells or even bacterial products notwithstanding capable of promoting a host immunological response. Antibiotic therapy, for example, might induce a block of bacterial division and the impossibility of recovering cells in civilisation media. In these cases, a molecular method targeting DNA should be used. In this study, 230 clinical samples with a culture-negative study obtained from 182 patients were examined with a protocol of PCR targeting the bacterial 16S rRNA gene to evaluate the usefulness of molecular methods in differencing culture-negative infections from other pathologies. Amplicons were obtained in 14% of the samples, although this percent increased (27%) in a subgroup of patients with presumptive diagnosis of infection and ongoing antibody therapy. By multiplex PCR, information technology was shown that detected DNA belonged generally to Enterobacteriaceae and enterococcal species. Multiple culture-negative, PCR-positive samples and isolation of the same bacterial species in culture in additional samples from the aforementioned patient support the clinical significance of the data obtained and highlight the complementary function and usefulness of applying molecular methods in diagnostic microbiology.

Introduction

A pregnant number of bacterial infection cases are not associated with the isolation of the causative agent when standard microbiological methods, based on isolation of bacteria in culture media, are applied ( Nikkari et al., 2002; Schabereiter-Gurtner et al., 2008; Esteban et al., 2012; Miyazato et al., 2012). Incorrect sampling, inadequate conservation of the specimen, low microbial concentration in the sample, but besides biological causes may be considered to explain this phenomenon. Autonomously from the possibility of a viral etiology, information technology has been hypothesized that failing in bacteria isolation might exist due to the involvement of microorganisms inappreciably growing or nonrecoverable in culture media ( Schabereiter-Gurtner et al., 2008; Rampini et al., 2011). During the infectious procedure, pathogens collaborate with host-produced substances or antibacterial drugs, causing inhibition of the bacterial growth, and the infection is usually stopped. Nonetheless, in an infected host, suboptimal concentrations of inhibitory molecules and stress conditions might induce the activation of survival mechanisms blocking the division capability of bacteria simply allowing them to stay alive (Domingue & Woody, 1997; Colwell, 2000; Lleo et al., 2001; Oliver, 2010; Castellani et al., 2013). These nondividing bacteria cannot be identified by standard diagnostic microbiological procedures based on culture techniques, and molecular methods should be practical as an alternative diagnostic arroyo ( Lleo et al., 2001; Oliver, 2010; Zandri et al., 2012).

Infections without an isolated causative amanuensis are specially frequent in some human being trunk districts. Equally an example, the diagnosis of bacterial pleural effusion is challenging, because conventional microbiologic diagnostic methods often give negative results ( Insa et al., 2012): The yield of conventional civilisation of pleural fluid (PLF) samples considered infected was studied and varied from 18% to 33% ( Insa et al., 2012). Similarly, difficulties in isolating and identifying the infectious microorganism involved are often encountered in infective endocarditis (Marí due north et al., 2007), intra-amniotic infections ( DiGiulio et al., 2008), meningitis ( Deutch et al., 2006; Welinder-Olsson et al., 2007), catheter-associated and bone and joint infections ( Fenollar et al., 2006).

Human biological fluids are frequently obtained from patients showing symptoms of infection in the corresponding body surface area to isolate and identify the etiological agent. Samples of this kind are as well taken to detect the presence of microorganisms in at-gamble patients showing particular pathological conditions (patients subjected to intestinal surgery, ascites in cirrhotic patients, hematological disorders, etc). To solve cases of undiagnosed bacterial infection, the use of 16S ribosomal ribonucleic acrid (rRNA) cistron polymerase chain reaction has proven to exist, in some cases, a reliable complement to civilisation techniques ( Rampini et al., 2011; Insa et al., 2012). However, some problems are institute in this respect mainly related to the nature of the clinical samples often containing polymerase-inhibiting molecules and components and to the possibility of DNA amplification from contaminant microorganisms or leaner of the man commensal microflora.

To evaluate the convenience and feasibility of developing and applying specific molecular protocols adjusted to the different clinical samples, the incidence of culture-negative but PCR-positive clinical samples has been evaluated in a collection of more than than 200 organic fluid samples obtained during years 2009–2011 at the University Hospital of Verona. Moreover, the results obtained have been compared with the clinical history of the patient in guild to investigate the causes of the culture-negative results and to evaluate the clinical significance of the PCR-positive samples and the usefulness of molecular methods in diagnostic microbiology.

Materials and methods

Patients and clinical samples

A collection of 230 clinical samples obtained from 182 patients were analyzed in this study. 20-one were external patients, while 161 patients were hospitalized in different hospital wards: 58 were located in the Surgical area, 51 in Internal Medicine, fifteen in the Infectious Diseases department, 13 patients in Hematology, 13 in the Intensive Intendance Unit of measurement (ICU), seven patients were hospitalized in Orthopedics, four in Pediatrics, and 1 patient in the Neurology unit of measurement (Supporting Data, Tabular array S1).

From all these patients, 85 samples of PLF, seventy of peritoneal drainage (PDr), 43 of synovial fluid (SNf), 14 samples of ascitic fluid (AF), seven samples of bile, and xi purulent specimens (PUS) were obtained. The different clinical samples were divided into two different groups, one including 75 samples obtained from patients (Group 1, symptomatic patients) in whom a diagnosis of suspected infection was posed on the footing of infection symptoms (11 SNfs, 25 pleural liquids, two AFs, five bile samples, and 32 PDr samples) and a second grouping (Group two, nonsymptomatic patients) including 155 samples taken to perform monitoring of a possible infection emergence in at-risk patients (data obtained from the clinician) and samples with no indications of the infectious state of the patient.

The samples were selected among those resulting culture-negative after analysis co-ordinate to standard microbiological methods at the Diagnostic Microbiology unit of the Verona University Infirmary. The standard microbiological method included microscopic observation of the sample after Gram staining and the inoculation of the sample in Columbia blood agar, mannitol-salt agar, McConkey agar, and Sabouraud agar media. An enrichment step was also performed for each 1 of the samples by inoculating an aliquot of the clinical specimen in blood civilization bottles and incubating them at 37 °C. Only those samples showing no bacterial growth after 4-day incubation were included in the study.

DNA extraction and purification

For DNA extraction, one mL of body fluid or drainage was centrifuged at 10 000 g for five min, and total Deoxyribonucleic acid was extracted from the pellet using a standard method. Briefly, the pellet was suspended in TE buffer containing ten% SDS to lyse the cells, and proteins were removed by digestion with proteinase K. Prison cell wall droppings, polysaccharides, and remaining proteins were removed by the phenol–chloroform standard protocol, and the DNA recovered by isopropanol atmospheric precipitation. The extracted Deoxyribonucleic acid was quantified spectrophotometrically.

PCR and multiplex PCR protocols

Bacterial universal PCR was performed using the pair of primers BR1 selected in the 16S rRNA gene region producing an amplicon of 804 bp (Table 1). A multiplex PCR protocol previously developed ( Lleo et al., 2005; Thalheimer et al., 2010) and targeting an Enterobacteriaceae DNA common region (EntB), the uidA gene encoding the Escherichia coli-specific beta-glucuronidase, and the Enterococcus faecalis species-specific pbp5 gene was likewise practical (Table 1).

Primers and target genes used to find bacterial Dna in civilisation-negative clinical samples

Primer Sequence Amplified gene Cistron product Amplicon size (in bp) Primer specificity (detected bacteria) Reference
BR1 GGACTACCAGGGTATCTAAT AGAGTTTGATCCTGGCT 16S rRNA factor Ribosomic Dna 16S 804 All Nikkari et al. (2002)
EntB TGAATCACAAAGTGGTAAGCG TGGGGATGACGTCAAGTCAT 16S rRNA gene Ribosomic DNA 16S 300 Enterobacteriaceae Lleo et al. (2005)
Eco ATCATGGAAGTAAGACTGC TTGCTGTGCCAGGCAGTTT uidA β-glucuronidase 356 Eastward. coli Fenollar et al. (2006)
pbp5 CATGAGCAATTAATCGG CATAGCCTGTCGCAAAAC pbp5 Penicillin-binding protein v 444 Due east. faecalis Lleo et al. (2006)
BG GGCTTCCTAGAGACCAATCA CAGAGAGCTGAACAAAGAGATT betaglobin Human beta-globin 295 Man cells Lleo et al. (2005)
Primer Sequence Amplified gene Gene production Amplicon size (in bp) Primer specificity (detected bacteria) Reference
BR1 GGACTACCAGGGTATCTAAT AGAGTTTGATCCTGGCT 16S rRNA cistron Ribosomic Dna 16S 804 All Nikkari et al. (2002)
EntB TGAATCACAAAGTGGTAAGCG TGGGGATGACGTCAAGTCAT 16S rRNA gene Ribosomic DNA 16S 300 Enterobacteriaceae Lleo et al. (2005)
Eco ATCATGGAAGTAAGACTGC TTGCTGTGCCAGGCAGTTT uidA β-glucuronidase 356 E. coli Fenollar et al. (2006)
pbp5 CATGAGCAATTAATCGG CATAGCCTGTCGCAAAAC pbp5 Penicillin-binding protein five 444 E. faecalis Lleo et al. (2006)
BG GGCTTCCTAGAGACCAATCA CAGAGAGCTGAACAAAGAGATT betaglobin Homo beta-globin 295 Human being cells Lleo et al. (2005)

Primers and target genes used to discover bacterial DNA in culture-negative clinical samples

Primer Sequence Amplified gene Cistron product Amplicon size (in bp) Primer specificity (detected bacteria) Reference
BR1 GGACTACCAGGGTATCTAAT AGAGTTTGATCCTGGCT 16S rRNA cistron Ribosomic Deoxyribonucleic acid 16S 804 All Nikkari et al. (2002)
EntB TGAATCACAAAGTGGTAAGCG TGGGGATGACGTCAAGTCAT 16S rRNA gene Ribosomic DNA 16S 300 Enterobacteriaceae Lleo et al. (2005)
Eco ATCATGGAAGTAAGACTGC TTGCTGTGCCAGGCAGTTT uidA β-glucuronidase 356 E. coli Fenollar et al. (2006)
pbp5 CATGAGCAATTAATCGG CATAGCCTGTCGCAAAAC pbp5 Penicillin-binding protein 5 444 E. faecalis Lleo et al. (2006)
BG GGCTTCCTAGAGACCAATCA CAGAGAGCTGAACAAAGAGATT betaglobin Human beta-globin 295 Human cells Lleo et al. (2005)
Primer Sequence Amplified gene Gene product Amplicon size (in bp) Primer specificity (detected bacteria) Reference
BR1 GGACTACCAGGGTATCTAAT AGAGTTTGATCCTGGCT 16S rRNA gene Ribosomic Dna 16S 804 All Nikkari et al. (2002)
EntB TGAATCACAAAGTGGTAAGCG TGGGGATGACGTCAAGTCAT 16S rRNA cistron Ribosomic DNA 16S 300 Enterobacteriaceae Lleo et al. (2005)
Eco ATCATGGAAGTAAGACTGC TTGCTGTGCCAGGCAGTTT uidA β-glucuronidase 356 East. coli Fenollar et al. (2006)
pbp5 CATGAGCAATTAATCGG CATAGCCTGTCGCAAAAC pbp5 Penicillin-binding protein 5 444 Due east. faecalis Lleo et al. (2006)
BG GGCTTCCTAGAGACCAATCA CAGAGAGCTGAACAAAGAGATT betaglobin Human being beta-globin 295 Human being cells Lleo et al. (2005)

PCR assays were carried out in a Factor Amp PCR Organisation 9700 thermal cycler (Perkin-Elmer) using a standard PCR protocol. The cycling conditions consisted of 5 min of initial denaturation at 95 °C, followed by 30 cycles consisting of 30-s denaturation at 95 °C, xxx-southward annealing at the adequate annealing temperature, and a 30-southward extension period at 72 °C with a terminal menses of 10-min extension. The amplification products were visualized after electrophoresis on a one.viii% agarose gel and ethidium bromide staining and photographed using an Image Master VDS (Pharmacia Biotech).

Distension products were purified with the QIAEX Two Gel Extraction Kit (Qiagen) and analyzed by sequencing (BMR Genomics, Padua, Italy).

In each run, a negative control with sterile, nuclease-free water was included. Moreover, two positive controls were used, i consisting of a PCR-negative AF spiked with 10iv E. coli cells to check the efficacy of the Dna extraction and purification protocol and another ane constituted by the same AF sample added with E. coli purified Dna to test the PCR efficiency. Every bit an internal control, a PCR targeting the gene encoding human beta-globin was included in each PCR series to rule out the possibility of PCR inhibition caused past inhibitory molecules still present in the sample afterward extraction and purification of the DNA.

Statistical analysis

The statistical assay (t-examination) was performed to establish whether the differences institute in the number of PCR-positive and PCR-negative samples within the two groups of patients were statistically significant or non. Data were analyzed using one-way anova followed by Dunnet's post hoc test for group comparisons. Significance was attributed when P < 0.05.

Results

Presence of bacterial Deoxyribonucleic acid in culture-negative clinical samples from symptomatic and nonsymptomatic patients

A protocol of PCR using universal primers selected in the 16S ribosomal RNA region and targeting whatever blazon of bacterial Dna was applied. Preliminary tests indicated that in most cases, PCR cannot be applied direct to the clinical samples, and the Dna has to be first extracted and purified. Some of the samples needed pretreatment with protease and/or low-speed centrifugation before extraction of Deoxyribonucleic acid considering they presented as gummy fabric or as specimens containing loftier quantities of cellular, proteinaceous, and/or fibrous material. Despite this pretreatment, eight samples, SNfs and pus, were eliminated from the written report as it was non possible to dilate the internal command.

The awarding of the PCR protocol to 222 culture-negative samples allowed united states to detect bactDNA in xiv% of the clinical fluids (xxx samples from 27 patients). Twenty samples containing bactDNA came from symptomatic patients with a presumptive diagnosis of infection (20/75 samples, 27%) while the other 10 PCR-positive samples (10/147 samples, seven%) were obtained from patients subjected to preventive monitoring (122 samples) or from patients without any information on possible ongoing or suspected infections (25 samples). The differences regarding the incidence of positive samples in the two groups of patients resulted statistically significant (P < 0.05). Most of the symptomatic patients (87%) had been subjected to antibiotic treatment for an average 9-twenty-four hours flow, while antibody therapy was applied to only 49% of the asymptomatic patients.

Of the bactDNA-positive samples, 14 were PLFs (16% of the pleural samples), five samples of SNf (13%), eight samples of PDr (11%), ii bile samples (28%), and one sample of AF (7%). Referring to samples obtained from symptomatic patients, PCR-positive pleural samples constitute 32% in symptomatic patients and simply eleven% in patients without a suspected infection. Similarly, PCR-positive PDrs represents 22% in symptomatic patients and iii% in asymptomatic ones, while SNfs with a positive PCR for bacterial DNA are 36% when an infection is suspected and 4% when obtained from nonsymptomatic patients. All the differences were statistically significant (P < 0.05).

Identification of the bacterial species DNA detected in clinical samples

The thirty PCR-positive samples were then analyzed using a multiplex PCR protocol targeting the entB sequence selected in a Deoxyribonucleic acid region mutual to all members of the Enterobacteriaceae family, the gene uidA encoding the E. coli β-glucuronidase, and an Eastward. faecalis species-specific gene (gene pbp5 encoding a cell wall penicillin-binding protein). After multiplex PCR, it was establish that sixteen/30 samples contained only DNA from Enterobacteriaceae, with 10 of the strains identified as E. coli, and iii/xxx contained East. faecalis and Enterobacteriaceae Deoxyribonucleic acid (two PDrs and one PLF) ( Table S1). Finally, 11 samples resulted negative for the presence of the iii targets of the multiplex PCR, thus indicating that these samples incorporate bacteria belonging to other groups. The identification at the species level, when not determined with the multiplex PCR, was completed by sequencing: 2 Klebsiella spp., one Klebsiella pneumoniae, 1 Enterobacter aerogenes, one Citrobacter spp., one Pseudomonas spp., two Staphylococcus aureus, four coagulase-negative Staphylococcus, two Enterococcus spp., and two Streptococcus spp. strains were identified ( Table S1). One strain belonging to enterobacteria was not identified at the species level.

Repetitiveness of the PCR results obtained in multiple samples from some of the patients

From 31 of the full patients, 2 or more clinical samples were obtained on different dates and analyzed for the presence of DNA past PCR (Table 2). Molecular analysis of the samples from twenty patients e'er resulted negative to the PCR targeting bacterial Deoxyribonucleic acid. On the contrary, each 1 of three patients (nine, 113, and 117) showed ii PCR-positive samples obtained on different dates or from different body sites: ii samples of SNf from patient 9 and 2 samples of pleural effusion from patient 113, taken at 1 week'due south altitude, resulted positive to the PCR targeting Enterobacteria. From patient 117, two unlike samples were obtained, PDr and PLF, both showing the presence of South. aureus Deoxyribonucleic acid.

Presence of bacterial Deoxyribonucleic acid detected by PCR applied to multiple samples obtained from a number of patients belonging to group i (*, symptomatic patients) or group 2 (not symptomatic patients)

Patient ID Clinical sample Sampling date Bact Deoxyribonucleic acid (PCR)
All samples positive
*9A SNf 03/05/06 East. aerogenes
*9B SNf 09/05/06 Enterobacteriaceae
*113A PLF 16/01/06 Klebsiella pneumoniae
*113B PLF 24/01/06 Klebsiella spp.
*117A PLF 26/06/06 Due south. aureus
*117B PDr 26/06/06 S. aureus
All samples negative
12A AF 06/02/06 Negative
12B PDr 23/03/06 Negative
16A PDr xx/02/06 Negative
16B PLF 24/07/06 Negative
*41A PLF 08/12/12 Negative
*41B PLF 12/12/06 Negative
52A AF 10/05/07 Negative
52B PLF 24/07/07 Negative
57A PLF 16/08/06 Negative
57B PLF 19/08/06 Negative
57C PLF 18/07/06 Negative
*61A SNf 06/07/06 Negative
*61B SNf 18/07/06 Negative
*61C SNf xviii/07/06 Negative
65A PDr 18/04/06 Negative
65B Bile 18/04/06 Negative
66A AF 07/05/07 Negative
66B AF xx/03/07 Negative
69A AF 10/07/07 Negative
69B AF 15/08/07 Negative
*70A PDr 15/12/06 Negative
*70B PDr 15/12/06 Negative
*70C PDr thirteen/12/06 Negative
*70D PDr thirteen/12/06 Negative
79A AF 04/04/07 Negative
79B PLF 19/03/07 Negative
89A PLF 04/05/06 Negative
89B PDr 23/03/06 Negative
91A PLF 24/11/06 Negative
91B PLF 30/11/06 Negative
97A PLF 06/11/06 Negative
97B PLF 27/10/06 Negative
97C PLF 06/eleven/06 Negative
*102A PLF 27/10/06 Negative
*102B PLF 27/10/06 Negative
118A SNf xvi/08/06 Negative
118B Pus 09/11/06 Negative
118C Pus 09/11/06 Negative
123A PLF 04/04/07 Negative
123B PLF 31/03/07 Negative
138A SNf 26/04/07 Negative
138B SNf 02/05/07 Negative
163A PLF 10/01/07 Negative
163B PLF 15/01/07 Negative
180A PDr 20/03/07 Negative
180B PDr thirteen/03/07 Negative
180C PDr 19/03/07 Negative
Some samples positive, some negative
*14A PLF 22/02/07 Negative
*14B PLF 25/02/07 Klebsiella spp.
*28A PDr thirteen/03/07 Citrobacter spp.
*28B PDr 16/03/07 Negative
*33A PDr 13/12/06 Due east. coli + East. faecalis
*33B PDr 22/12/06 Negative
*46A PDr 16/08/06 East. coli
*46B PDr 17/08/06 Negative
*46C Bile 17/08/06 Negative
*46D Bile 17/08/06 Negative
*47A PLF 11/12/06 Negative
*47B PDr eleven/12/06 Negative
*47C PDr 12/12/06 Enterococcus spp.
*47D PDr fifteen/01/07 Negative
*53A PLF 24/05/06 Pseudomonas spp.
*53B PLF 16/07/06 Negative
*92A PDr 23/03/06 Enterococcus spp.
*92B PDr 27/03/06 Negative
*168A Bile 20/02/06 Negative
*168B PDr twenty/02/06 E. coli + E. faecalis
Patient ID Clinical sample Sampling engagement Bact DNA (PCR)
All samples positive
*9A SNf 03/05/06 E. aerogenes
*9B SNf 09/05/06 Enterobacteriaceae
*113A PLF 16/01/06 Klebsiella pneumoniae
*113B PLF 24/01/06 Klebsiella spp.
*117A PLF 26/06/06 S. aureus
*117B PDr 26/06/06 South. aureus
All samples negative
12A AF 06/02/06 Negative
12B PDr 23/03/06 Negative
16A PDr xx/02/06 Negative
16B PLF 24/07/06 Negative
*41A PLF 08/12/12 Negative
*41B PLF 12/12/06 Negative
52A AF 10/05/07 Negative
52B PLF 24/07/07 Negative
57A PLF sixteen/08/06 Negative
57B PLF 19/08/06 Negative
57C PLF 18/07/06 Negative
*61A SNf 06/07/06 Negative
*61B SNf eighteen/07/06 Negative
*61C SNf 18/07/06 Negative
65A PDr 18/04/06 Negative
65B Bile 18/04/06 Negative
66A AF 07/05/07 Negative
66B AF xx/03/07 Negative
69A AF 10/07/07 Negative
69B AF fifteen/08/07 Negative
*70A PDr 15/12/06 Negative
*70B PDr 15/12/06 Negative
*70C PDr 13/12/06 Negative
*70D PDr 13/12/06 Negative
79A AF 04/04/07 Negative
79B PLF 19/03/07 Negative
89A PLF 04/05/06 Negative
89B PDr 23/03/06 Negative
91A PLF 24/11/06 Negative
91B PLF 30/xi/06 Negative
97A PLF 06/11/06 Negative
97B PLF 27/x/06 Negative
97C PLF 06/11/06 Negative
*102A PLF 27/ten/06 Negative
*102B PLF 27/x/06 Negative
118A SNf sixteen/08/06 Negative
118B Pus 09/11/06 Negative
118C Pus 09/11/06 Negative
123A PLF 04/04/07 Negative
123B PLF 31/03/07 Negative
138A SNf 26/04/07 Negative
138B SNf 02/05/07 Negative
163A PLF 10/01/07 Negative
163B PLF 15/01/07 Negative
180A PDr 20/03/07 Negative
180B PDr 13/03/07 Negative
180C PDr 19/03/07 Negative
Some samples positive, some negative
*14A PLF 22/02/07 Negative
*14B PLF 25/02/07 Klebsiella spp.
*28A PDr 13/03/07 Citrobacter spp.
*28B PDr 16/03/07 Negative
*33A PDr thirteen/12/06 E. coli + E. faecalis
*33B PDr 22/12/06 Negative
*46A PDr sixteen/08/06 E. coli
*46B PDr 17/08/06 Negative
*46C Bile 17/08/06 Negative
*46D Bile 17/08/06 Negative
*47A PLF 11/12/06 Negative
*47B PDr 11/12/06 Negative
*47C PDr 12/12/06 Enterococcus spp.
*47D PDr xv/01/07 Negative
*53A PLF 24/05/06 Pseudomonas spp.
*53B PLF 16/07/06 Negative
*92A PDr 23/03/06 Enterococcus spp.
*92B PDr 27/03/06 Negative
*168A Bile 20/02/06 Negative
*168B PDr 20/02/06 East. coli + E. faecalis

Presence of bacterial Dna detected past PCR applied to multiple samples obtained from a number of patients belonging to group 1 (*, symptomatic patients) or group 2 (not symptomatic patients)

Patient ID Clinical sample Sampling date Bact DNA (PCR)
All samples positive
*9A SNf 03/05/06 E. aerogenes
*9B SNf 09/05/06 Enterobacteriaceae
*113A PLF sixteen/01/06 Klebsiella pneumoniae
*113B PLF 24/01/06 Klebsiella spp.
*117A PLF 26/06/06 S. aureus
*117B PDr 26/06/06 S. aureus
All samples negative
12A AF 06/02/06 Negative
12B PDr 23/03/06 Negative
16A PDr 20/02/06 Negative
16B PLF 24/07/06 Negative
*41A PLF 08/12/12 Negative
*41B PLF 12/12/06 Negative
52A AF x/05/07 Negative
52B PLF 24/07/07 Negative
57A PLF sixteen/08/06 Negative
57B PLF 19/08/06 Negative
57C PLF 18/07/06 Negative
*61A SNf 06/07/06 Negative
*61B SNf 18/07/06 Negative
*61C SNf eighteen/07/06 Negative
65A PDr xviii/04/06 Negative
65B Bile 18/04/06 Negative
66A AF 07/05/07 Negative
66B AF 20/03/07 Negative
69A AF x/07/07 Negative
69B AF 15/08/07 Negative
*70A PDr 15/12/06 Negative
*70B PDr 15/12/06 Negative
*70C PDr 13/12/06 Negative
*70D PDr 13/12/06 Negative
79A AF 04/04/07 Negative
79B PLF 19/03/07 Negative
89A PLF 04/05/06 Negative
89B PDr 23/03/06 Negative
91A PLF 24/11/06 Negative
91B PLF 30/xi/06 Negative
97A PLF 06/11/06 Negative
97B PLF 27/10/06 Negative
97C PLF 06/11/06 Negative
*102A PLF 27/10/06 Negative
*102B PLF 27/10/06 Negative
118A SNf 16/08/06 Negative
118B Pus 09/xi/06 Negative
118C Pus 09/11/06 Negative
123A PLF 04/04/07 Negative
123B PLF 31/03/07 Negative
138A SNf 26/04/07 Negative
138B SNf 02/05/07 Negative
163A PLF 10/01/07 Negative
163B PLF 15/01/07 Negative
180A PDr 20/03/07 Negative
180B PDr 13/03/07 Negative
180C PDr 19/03/07 Negative
Some samples positive, some negative
*14A PLF 22/02/07 Negative
*14B PLF 25/02/07 Klebsiella spp.
*28A PDr thirteen/03/07 Citrobacter spp.
*28B PDr 16/03/07 Negative
*33A PDr 13/12/06 Eastward. coli + E. faecalis
*33B PDr 22/12/06 Negative
*46A PDr 16/08/06 East. coli
*46B PDr 17/08/06 Negative
*46C Bile 17/08/06 Negative
*46D Bile 17/08/06 Negative
*47A PLF 11/12/06 Negative
*47B PDr 11/12/06 Negative
*47C PDr 12/12/06 Enterococcus spp.
*47D PDr 15/01/07 Negative
*53A PLF 24/05/06 Pseudomonas spp.
*53B PLF 16/07/06 Negative
*92A PDr 23/03/06 Enterococcus spp.
*92B PDr 27/03/06 Negative
*168A Bile 20/02/06 Negative
*168B PDr twenty/02/06 Eastward. coli + E. faecalis
Patient ID Clinical sample Sampling date Bact Deoxyribonucleic acid (PCR)
All samples positive
*9A SNf 03/05/06 E. aerogenes
*9B SNf 09/05/06 Enterobacteriaceae
*113A PLF 16/01/06 Klebsiella pneumoniae
*113B PLF 24/01/06 Klebsiella spp.
*117A PLF 26/06/06 S. aureus
*117B PDr 26/06/06 S. aureus
All samples negative
12A AF 06/02/06 Negative
12B PDr 23/03/06 Negative
16A PDr 20/02/06 Negative
16B PLF 24/07/06 Negative
*41A PLF 08/12/12 Negative
*41B PLF 12/12/06 Negative
52A AF x/05/07 Negative
52B PLF 24/07/07 Negative
57A PLF xvi/08/06 Negative
57B PLF 19/08/06 Negative
57C PLF xviii/07/06 Negative
*61A SNf 06/07/06 Negative
*61B SNf 18/07/06 Negative
*61C SNf 18/07/06 Negative
65A PDr 18/04/06 Negative
65B Bile 18/04/06 Negative
66A AF 07/05/07 Negative
66B AF 20/03/07 Negative
69A AF 10/07/07 Negative
69B AF 15/08/07 Negative
*70A PDr 15/12/06 Negative
*70B PDr 15/12/06 Negative
*70C PDr xiii/12/06 Negative
*70D PDr 13/12/06 Negative
79A AF 04/04/07 Negative
79B PLF 19/03/07 Negative
89A PLF 04/05/06 Negative
89B PDr 23/03/06 Negative
91A PLF 24/11/06 Negative
91B PLF 30/11/06 Negative
97A PLF 06/eleven/06 Negative
97B PLF 27/10/06 Negative
97C PLF 06/xi/06 Negative
*102A PLF 27/x/06 Negative
*102B PLF 27/ten/06 Negative
118A SNf 16/08/06 Negative
118B Pus 09/xi/06 Negative
118C Pus 09/11/06 Negative
123A PLF 04/04/07 Negative
123B PLF 31/03/07 Negative
138A SNf 26/04/07 Negative
138B SNf 02/05/07 Negative
163A PLF 10/01/07 Negative
163B PLF fifteen/01/07 Negative
180A PDr twenty/03/07 Negative
180B PDr thirteen/03/07 Negative
180C PDr 19/03/07 Negative
Some samples positive, some negative
*14A PLF 22/02/07 Negative
*14B PLF 25/02/07 Klebsiella spp.
*28A PDr 13/03/07 Citrobacter spp.
*28B PDr 16/03/07 Negative
*33A PDr 13/12/06 E. coli + Eastward. faecalis
*33B PDr 22/12/06 Negative
*46A PDr xvi/08/06 E. coli
*46B PDr 17/08/06 Negative
*46C Bile 17/08/06 Negative
*46D Bile 17/08/06 Negative
*47A PLF 11/12/06 Negative
*47B PDr 11/12/06 Negative
*47C PDr 12/12/06 Enterococcus spp.
*47D PDr xv/01/07 Negative
*53A PLF 24/05/06 Pseudomonas spp.
*53B PLF sixteen/07/06 Negative
*92A PDr 23/03/06 Enterococcus spp.
*92B PDr 27/03/06 Negative
*168A Bile 20/02/06 Negative
*168B PDr 20/02/06 Eastward. coli + Eastward. faecalis

The eight other patients presented some samples positive and some negative as regards the presence of bactDNA (Table 2). Patient 14 showed the presence of Klebsiella Deoxyribonucleic acid in a pleural sample obtained 3 days after a PCR-negative result in the aforementioned type of fluid. Patient number 168 had a positive PCR peritoneal sample but a negative bile specimen. In all the other cases, patients 28, 33, 46, 53, and 92, the first sample obtained resulted positive to the PCR, while subsequent sampling gave negative results. All these patients except the patient 92 undergone antibody therapy. Equally an exception, patient 47 had a PCR-positive peritoneal sample taken on an intermediate date with respect to other samples resulting negative to PCR.

Analysis of the patients showing bactDNA in their culture-negative clinical samples

To evaluate the clinical significance of the presence of bacterial DNA in civilization-negative samples, only the 27 patients with at to the lowest degree one PCR-positive sample were considered. It was possible to recover from the hospital database the microbiological anamnesis of but 18 of these 27 patients to perform a retrospective analysis. Table S2 details the information recorded from 18 patients, and the bacterial species isolated and identified afterwards application of the culture method to i or more other clinical samples obtained in the days or months effectually the sampling engagement of the specimen examined in PCR. Every bit far as patients nine, 33, 37, 48, and 108 are concerned, there is no correspondence between the Dna species detected by PCR, and the bacterial species isolated from other body sites or on other sampling dates using the culture method ( Table S2). For patients 14, 56, 92, 145, 146, 168, and 172, the samples examined using the culture method were all recorded as negative. Interestingly, clinical samples obtained from patients 46, 47, 53, 113, 117, and 150 and analyzed both past culture and PCR methods in this written report showed the presence of the aforementioned bacterial species isolated from the same patient in other samples non examined in this study only recovered from the hospital database (Table 3). Specifically, for patient 46, all the bile samples examined resulted negative, while the peritoneal fluid (PERf) resulted positive only past PCR 4 days after the isolation of E. coli in culture. Pseudomonas Deoxyribonucleic acid was detected in the PLF of patient 53, from which a Pseudomonas aeruginosa was isolated 2 weeks before in the lung. Similarly, E. coli was isolated from patient 47 in both culturable and nonculturable forms in different clinical samples. A Klebsiella was isolated in culture media from the bile and blood of patient 113, which in the same days shown the presence of just Klebsiella DNA in PLF. From patient 117, S. aureus was isolated in civilisation from different clinical samples obtained over a flow of ane month, although in the two samples of the 24-hour interval 26/06 it was not possible to isolate culturable bacteria but just bacterial Dna (Tabular array iii). Finally, an E. coli was recovered in civilization from PERfs of patient 150, while in the AF of the same patient, the E. coli was detected only by PCR. To ostend the information obtained from these half dozen patients, all the samples from which culturable bacteria were obtained were later on examined by PCR: All the samples merely the E. coli establish in the surgical wound (Swnd) sample from patient 117 gave positive PCR results.

Temporal analysis of the results obtained with standard culture method and PCR in a series of patients with a presumptive diagnosis of infection

Temporal analysis of the results obtained with standard culture method and PCR in a serial of patients with a presumptive diagnosis of infection

Discussion

PCR targeting 16S rRNA factor has proven useful for the detection and identification of live or expressionless leaner in cases of suspected infection in patients undergoing antibody therapy and in symptomatic patients with a culture-negative microbiological report ( Rogers et al., 2010; Rampini et al., 2011; Insa et al., 2012). Civilization-negative microbiological reports are frequent in symptomatic infections in some body areas such as the pleural space, bone and joint spaces, and endocardium from which instead samples result positive to PCR targeting bacterial Dna (Marí north et al., 2007; Esteban et al., 2012; Grif et al., 2012; Insa et al., 2012) are obtained. The presence of naked bacterial Dna and other bacterial products (endotoxin, peptidoglycan) has been demonstrated in clinical samples of symptomatic and asymptomatic patients, oftentimes associated with bacteria intestinal translocation ( Thalheimer et al., 2010; Bellot et al., 2013) and might be associated with at to the lowest degree a number of cases of culture-negative, PCR-positive microbiological reports. The persistence of these bacterial components in the homo torso has non been sufficiently investigated, but their rapid emptying can be hypothesized as a consequence of the immunological response. The involvement of injured, starved, and feasible just nonculturable (VBNC) bacteria in cases of infection with civilisation-negative, PCR-positive report has been suggested in that these microbial forms are hardly or not at all recoverable in culture media, can represent survival strategies, activated as well by an antibiotic treatment, and seem to keep their pathogenicity potential (Rivers & Steck, 2001; Aurass et al., 2011; Senoh et al., 2012). A serial of culture-negative clinical specimens, obtained from unlike patients and trunk sites, were analyzed for the presence of bacterial Deoxyribonucleic acid to identify cases of infection in which nonculturable bacteria might be involved. A pregnant percentage of these culture-negative samples (14%) in fact contained bacterial Dna, in many cases detected not just with a universal pair of primers but also with primers targeting Enterobacteriaceae and enterococcal genes. This percentage of civilization-negative, PCR-positive samples increased to 27% when merely the patients with symptomatic infections were considered. Pleural, synovial, and PERfs were the samples with the highest frequency of Deoxyribonucleic acid presence, while none of the pus specimens and only seven% of AF samples resulted positive to PCR. Although a 28% frequency of PCR positivity has been found in the example of bile samples, this percentage is not significant due to the low number of samples analyzed (only eight bile samples). Equally regards the bacterial species isolated, more than than one one-half were strains belonging to the Enterobacteriaceae family, equally expected considering that a considerable part of the samples examined came from the abdominal expanse. DNA from enterococcal, streptococcal, and staphylococcal strains was also detected. All were bacterial species very ofttimes involved in homo infections so that the civilization-negative, PCR-positive effect cannot be ascribed to the involvement of rare bacterial species difficult to be cultured.

The clinical significance of the presence of DNA in culture-negative samples has been questioned. The conserved nature of ribosomal genome sequence across the different genera of bacteria and the high sensitivity of PCR allowing the detection of bacterial DNA fifty-fifty when present in extremely low concentrations brand a PCR-positive sample ever liable to be associated with a contamination. In our hands, the sensitivity of the PCR protocol was virtually five pg of Deoxyribonucleic acid corresponding to about 500 cells/reaction. In some studies, the need has been highlighted to view the PCR results with caution, as at least some of the positive results obtained in the laboratory were thought to be due to environmental contaminants ( Rampini et al., 2011). It should also be considered that a high proportion of the samples submitted for microbiological analysis and included in this study were obtained from patients without any bear witness of infection, as judged by retrospective medical record review. In addition, the fact that bacterial DNA is found in a clinical sample does non necessarily mean that there is an infection: Bacteria may be detected at diverse sites as a result of colonization or translocation, especially if sensitive methodologies are used. Still, the statistically significant difference regarding the PCR-positive results obtained from patients with and without a presumptive diagnosis of infection (27% of symptomatic patients vs. 7% of nonsymptomatic ones) supports the significance of the data presented here.

In our study, particularly interesting are those 31 patients from whom several clinical samples were examined: Multiple PCR-negative and culture-negative results should definitively exclude the presence of microorganisms in the site of presumptive/suspected infection. More than difficult to explicate are the results obtained from those eight patients showing both PCR-positive and PCR-negative samples. For patients 14, 28, 33, 92, and 168, we cannot exclude a possible contamination in that a unmarried PCR-positive sample, amidst samples examined with the culture and/or PCR methods, was detected. At the same fourth dimension, the significance of the single result cannot exist excluded either, in that all these patients presented symptoms of infection. On the contrary, the presence of bacterial DNA in two or more samples would confirm the consistent presence of this bacterial component excluding a possibility of contamination during the experiments. Moreover, the isolation in civilisation of bacteria belonging to the same species or grouping in a divers period of time once again supports the significance of the PCR-positive outcome.

Focusing on the vi patients with congruent results, that is, with the same bacterial species in samples subjected to culture and/or molecular methods, it is interesting to notation that all of them belonged to the group of patients with a symptomatic infection, and all of them were treated with antibiotics. 5 of these patients had initial civilization-positive samples followed by simply civilization-negative, PCR-positive specimens. In subsequent samples from patients 47, 53, and 150, the same bacterial species were recovered once again in civilization. We suggest that these results tin can be associated with a not completely effective antibiotic treatment causing the transitory inhibition of bacteria or killing only a sure percentage of the bacterial population. For patients 46 and 117, civilisation-positive records were not establish in the hospital database on dates subsequent to that of the culture-negative, PCR-positive sample. Information technology could be possible that in these 2 later cases, the inhibition of bacterial growth led to lethal terminal consequences. In both situations, the activation of survival strategies and the formation of nonculturable simply viable bacteria cannot be excluded. Patient 113 presented initial culture-negative, PCR-positive samples (two positive samples inside a week) and subsequent generalized infection and isolation in civilization of the same bacterial species previously detected. Different explanations might exist provided in this case, low bacterial concentration at the beginning of the infectious process, resuscitation of VBNC leaner, but in any case it seems clear that the possibility of having an early on indication of the presence of bacterial products in a body area might be useful in managing the emergence of a bacterial infection.

To sum up, the data obtained in this study point that in a meaning number of culture-negative clinical samples, specially from symptomatic patients with a presumptive diagnosis of infection and ongoing antibiotic therapy, bacterial components and/or nonculturable bacterial forms take been detected supporting a complementary role of molecular methods in diagnostic microbiology. The clinical significance and the prognostic value of these findings, although they accept to be more deeply investigated, tin can be established at least in some patients, when application of the standard culture method provides reports non consistent with the patient'southward clinical symptoms or when the patient is subjected to antibody treatment.

Acknowledgement

This study was partially supported by Grant MIUR-PRIN 2008 from the Ministero dell'Istruzione, dell'Università eastward della Ricerca (MIUR), Rome, Italy.

References

(

2011

)

EHEC/EAEC O104:H4 strain linked with the 2011 German outbreak of haemolytic uremic syndrome enters into the feasible but non-culturable land in response to diverse stresses and resuscitates upon stress relief

.

Environ Microbiol

thirteen

:

3139

–

3148

.

(

2013

)

Pathological bacterial translocation in cirrhosis: pathophysiology, diagnosis and clinical implications

.

Liver Int

33

:

31

–

39

.

(

2013

)

Fate of pathogenic leaner in microcosms mimicking man trunk sites

.

Microb Ecol

66

:

224

–

231

.

(

2000

)

Feasible simply nonculturable leaner: a survival strategy

.

J Infect Chemother

6

:

121

–

125

.

(

2006

)

Broad-range real fourth dimension PCR and DNA sequencing for the diagnosis of bacterial meningitis

.

Scand J Infect Dis

38

:

27

–

35

.

(

2008

)

Microbial prevalence, diverseness and abundance in amniotic fluid during preterm labor: a molecular and culture-based investigation

.

PLoS One

3

:

e3056

.

(

1997

)

Bacterial persistence and expression of disease

.

Clin Microbiol Rev

10

:

320

–

344

.

(

2012

)

PCR-hybridization after sonication improves diagnosis of implant-related infection

.

Acta Orthop

83

:

299

–

304

.

(

2006

)

Assay of 525 samples to determine the usefulness of PCR distension and sequencing of the 16S rRNA gene for diagnosis of bone and joint infections

.

J Clin Microbiol

44

:

1018

–

1028

.

(

2012

)

Improvement of detection of bacterial pathogens in usually sterile body sites with a focus on orthopedic samples by use of a commercial 16S rRNA broad-range PCR and sequence analysis

.

J Clin Microbiol

fifty

:

2250

–

2254

.

(

2012

)

Systematic use of universal 16S rRNA gene polymerase chain reaction (PCR) and sequencing for processing pleural effusions improves conventional civilisation techniques

.

Medicine (Baltimore)

91

:

103

–

110

.

(

2001

)

Resuscitation rate in different enterococcal species in the feasible but non-culturable state

.

J Appl Microbiol

91

:

1095

–

1102

.

(

2005

)

Molecular vs culture methods for the detection of bacterial faecal indicators in groundwater for human use

.

Lett Appl Microbiol

40

:

289

–

294

.

&

Grouping for the Management of Infective Endocarditis of the Gregorio Marañón Hospital

(

2007

)

Molecular diagnosis of infective endocarditis by real-time broad-range polymerase chain reaction (PCR) and sequencing directly from center valve tissue

.

Medicine (Baltimore)

86

:

195

–

202

.

(

2012

)

Comparative molecular and microbiological diagnosis of 19 infective endocarditis cases in which causative microbes were identified by PCR-based Deoxyribonucleic acid sequencing from the excised middle valves

.

J Infect Chemother

xviii

:

318

–

323

.

(

2002

)

Broad-range bacterial detection and the analysis of unexplained death and disquisitional illness

.

Emerg Infect Dis

8

:

188

–

194

.

(

2010

)

Contempo findings on the feasible but nonculturable state in pathogenic bacteria

.

FEMS Microbiol Rev

34

:

415

–

425

.

(

2011

)

Broad-range 16S rRNA gene polymerase chain reaction for diagnosis of culture-negative bacterial infections

.

Clin Infect Dis

53

:

1245

–

1251

.

(

2001

)

Feasible but nonculturable uropathogenic bacteria are nowadays in the mouse urinary tract following urinary tract infection and antibody therapy

.

Urol Res

29

:

60

–

66

.

(

2010

)

Characterisation of bacteria in ascites–reporting the potential of culture-independent, molecular assay

.

Eur J Clin Microbiol Infect Dis

29

:

533

–

541

.

(

2008

)

Evaluation of a protocol for molecular wide-range diagnosis of civilization-negative bacterial infections in clinical routine diagnosis

.

J Appl Microbiol

104

:

1228

–

1237

.

(

2012

)

Conversion of viable just nonculturable enteric bacteria to culturable by co-culture with eukaryotic cells

.

Microbiol Immunol

56

:

342

–

345

.

et al. (

2010

)

Altered intestinal function precedes the advent of bacterial DNA in serum and ascites in patients with cirrhosis: a pilot study

.

Eur J Gastroenterol Hepatol

22

:

1228

–

1234

.

(

2007

)

Comparison of broad-range bacterial PCR and culture of cerebrospinal fluid for diagnosis of community-acquired bacterial meningitis

.

Clin Microbiol Infect

13

:

879

–

886

.

(

2012

)

Detection of viable but non-culturable staphylococci in biofilms from fundamental venous catheters negative on standard microbiological assays

.

Clin Microbiol Infect

18

:

259

–

261

.

Supporting Information

Table S1. Presence of bacterial Dna in civilization-negative clinical samples from symptomatic (Grouping ane) and nonsymptomatic (Grouping ii) patients.

Tabular array S2. Civilization-positive reports obtained (hospital database) from xviii patients resulting positive to Bact-Dna PCR.

Author notes

Editor: Marilyn Roberts

jackfient1990.blogspot.com

Source: https://academic.oup.com/femsle/article/354/2/153/498502

0 Response to "how to know what bacteria a pcr product is for an unknown organism"

Postar um comentário

Iklan Atas Artikel

Iklan Tengah Artikel 1

Iklan Tengah Artikel 2

Iklan Bawah Artikel